Aeromonas hydrophila Detection Testing Services: Comprehensive Pathogen Surveillance for Aquaculture & Water Safety

As an independent third-party testing service provider, we offer comprehensive detection and identification services for Aeromonas hydrophila – a Gram-negative, facultatively anaerobic, rod‑shaped bacterium belonging to the family Aeromonadaceae[reference:0]. This bacterium is widely distributed in natural freshwater environments and is a major opportunistic pathogen in aquaculture, causing haemorrhagic septicaemia (also known as “motile aeromonad septicaemia” or MAS) in a broad range of fish species, amphibians, reptiles, and even humans[reference:1][reference:2]. In fish farming, A. hydrophila infection is characterised by rapid onset, high mortality, and significant economic losses, particularly in high‑density culture systems. In humans, the bacterium is associated with gastroenteritis, wound infections, and, in immunocompromised individuals, more severe systemic infections[reference:3]. Our accredited laboratory follows international and national standards (ISO, GB/T, SC/T 7014, SC/T 7201.3, SN/T 0751) using conventional culture, biochemical fingerprinting, molecular detection (PCR, real‑time PCR), and immunological assays (ELISA) to deliver accurate, reproducible, and legally defensible test data. This article outlines our A. hydrophila detection capabilities – including scope, key test items, and standard test methods – to help aquaculture producers, feed manufacturers, water quality managers, food safety regulators, and veterinary diagnostic laboratories monitor and control this economically important pathogen.

1. Our Testing Scope for Aeromonas hydrophila Detection

We cover a wide range of sample matrices, testing purposes, and regulatory compliance requirements:

By sample matrix / specimen type: Aquaculture samples – fish (whole fish, gill swabs, kidney, liver, spleen, ascitic fluid, intestinal contents), shrimp, crab, shellfish, frogs, turtles; Water and environmental samples – pond water, recirculating aquaculture system (RAS) water, effluent discharge, hatchery water, sediment, algal biofilm; Feed and feed ingredients – commercial fish feed, live bait, frozen feed; Processed seafood – fresh, chilled, frozen fish fillets, crustaceans, molluscs (for export compliance); Diagnostic specimens – tissue homogenates, swabs, isolates submitted for confirmatory identification; Human clinical samples – stool, wound swabs (by arrangement with clinical partners).

By detection objective / use case: Disease outbreak investigation – identification of the causative agent in mass mortality events; Routine health monitoring – surveillance of asymptomatic carriage in broodstock, fingerlings, and grow‑out populations; Import/export quarantine – compliance with international trade regulations (e.g., OIE guidelines, EU, USFDA)[reference:4]; Water quality surveillance – monitoring of pathogen load in source water, RAS, and effluent; Feed safety testing – verifying absence of A. hydrophila in aquaculture feeds and live feeds; Treatment efficacy evaluation – monitoring pathogen clearance following antibiotic or disinfectant treatment; Biosecurity auditing – facility environmental swabbing for certification programmes.

By detection target / variant: Genus‑level detection – identification of any Aeromonas species present; Species‑specific identification – definitive identification of A. hydrophila distinguishing it from A. caviae, A. veronii, A. sobria, and other related species; Pathotype discrimination – differentiation between virulent (toxin‑producing) and avirulent strains; Genetic profiling – detection of specific toxin genes and virulence‑associated markers (see Section 2.3).

By regulatory framework / standard: SC/T 7014‑2006 (Aquatic animal quarantine laboratory technical specifications) – applicable to quarantine of live aquatic animals and primary processed products[reference:5]; SC/T 7201.3‑2006 (Fish bacterial disease quarantine technical specification – Part 3: Diagnostic method for Aeromonas hydrophila and Aeromonas caviae enteritis) – specifies the standard procedure for isolation, identification, and diagnosis[reference:6]; SN/T 0751 (Import and export food safety standard for Aeromonas spp. detection) – applicable to processed seafood export testing; GB/T 18652 (Pathogenic Aeromonas hydrophila detection methods) – Chinese national standard for veterinary diagnostics; OIE Aquatic Animal Health Code – Chapter 2.3.6: infection with Aeromonas hydrophila (not currently listed, but reference testing methods are provided).

2. Key Test Items & Measurements We Perform

Our Aeromonas hydrophila detection services are organised into four integrated domains, covering everything from basic isolation to advanced molecular characterisation and virulence profiling. Each domain addresses critical requirements for aquaculture diagnostics, biosecurity surveillance, and regulatory compliance.

2.1 Isolation & Culture‑Based Detection (Gold Standard for Live Bacteria)

The conventional culture method remains the “gold standard” for confirming viable A. hydrophila in clinical and environmental samples. Our routine workflow is designed to recover the bacterium from a wide variety of matrices with high sensitivity and specificity[reference:7].

Sample processing – Solid tissues (kidney, liver, spleen, gill) are homogenised in sterile phosphate‑buffered saline (PBS) or brain‑heart infusion (BHI) broth. Swabs are vortexed in transport medium. Water samples (≥ 100 mL) are filtered through a 0.45 μm membrane filter, and the filter is placed directly on selective agar. Liquid samples and homogenates are serially diluted in 0.85% sterile saline.

Selective and differential media – We use a two‑plate approach to maximise recovery and differentiation: Starch‑ampicillin agar (SAA) – starch hydrolysis (clear zone) and ampicillin resistance (32 μg/mL) are characteristic of A. hydrophila; colonies appear as yellow, convex, 2‑3 mm diameter. RS agar (Rimler‑Shotts medium) – a highly selective medium for Aeromonas spp., producing yellow colonies with yellow halos (due to acid production from sucrose). Ampicillin blood agar (ABA) – for detection of haemolytic activity (β‑haemolysis is common in virulent isolates). Additional confirmatory agars include TSA (trypticase soy agar) for morphological observation (greyish‑white, opaque, round colonies) and TCBS agar (thiosulfate‑citrate‑bile salts‑sucrose) – A. hydrophila grows as small, yellow colonies[reference:8]. Incubation temperature: 28‑30°C for 24‑48 hours. Typical colonies are counted, and representative colonies are selected for further identification[reference:9].

Limits of detection – For water and liquid samples, the membrane filtration method can detect as low as 1 CFU/100 mL. For tissue samples, the limit is approximately 10‑100 CFU/g after enrichment.

2.2 Biochemical Confirmation & Phenotypic Identification

Presumptive colonies from selective media are confirmed as A. hydrophila using a standardised panel of biochemical tests[reference:10]. This step is essential for species‑level identification, particularly because other Aeromonas species may grow on the same selective media.

Essential confirmatory tests – Gram stain – Gram‑negative, straight or slightly curved rods, 0.8‑1.0 μm × 1.0‑3.5 μm (often appearing in pairs, with a single polar flagellum when motile). Oxidase test – positive (characteristic of Aeromonas spp.). Catalase test – positive. Oxidation/fermentation (OF) test – facultatively anaerobic, oxidative and fermentative. Triple sugar iron (TSI) agar – acid/acid or alkaline/acid with gas production (typical for Aeromonas). Indole test – positive. Methyl red (MR) – positive. Voges‑Proskauer (VP) – variable (often negative for A. hydrophila). Citrate utilisation – positive (Simmons‘ citrate). Hydrogen sulfide (H₂S) production – negative on TSI (unlike Salmonella). Motility – positive (non‑flagellated strains are rare; requires observation of flagella with specialised staining or electron microscopy).

Specialised biochemical test kits – For rapid and automated identification, we use commercial systems: API 20E (bioMérieux) – numerical profile database matched against the 20‑test strip; VITEK® 2 GN card – fully automated identification with results in 4‑6 hours; MALDI‑TOF MS – identification based on protein spectral fingerprinting (highly accurate, same‑day results from isolated colonies).

Interpretation criteria – For culture‑based confirmation, a definitive identification as A. hydrophila requires a positive result for at least: oxidase (+), indole (+), glucose fermentation (+), production of acid from mannitol, and resistance to the vibriostatic agent O/129 (150 μg). Additionally, the isolate should be negative for arginine dihydrolase (some references) and should not require sodium chloride for growth (differentiating from vibrios).

3.3 Virulence Gene Detection (Toxin Gene Profiling & Pathogenicity Assessment)

This service is essential for distinguishing highly virulent strains from avirulent or environmental isolates, particularly in surveillance programmes, outbreak investigations, and feed safety assessments.

Toxin gene detection by PCR (target genes) – hlyA (haemolysin) – encodes β‑haemolysin, which lyses red blood cells and contributes to tissue damage[reference:11][reference:12]. aerA (aerolysin) – encodes a potent pore‑forming cytolytic toxin, a key virulence factor in pathogenic strains[reference:13]. act (cytotoxic enterotoxin) – encodes a multifunctional toxin with enterotoxic and cytotoxic activities. alt (heat‑labile enterotoxin) – associated with diarrhoea. ast (heat‑stable enterotoxin) – small, heat‑stable toxin. lip (lipase) – contributes to tissue destruction. ahp (serine protease) – extracellular protease that damages host tissues and degrades complement proteins[reference:14]. fla (flagellin) – associated with motility and adhesion to host cells. omp (outer membrane protein) – involved in adhesion and immune evasion.

Pathogenicity assessment – By comparing the presence of toxin genes between isolates, our service helps classify strains into: highly pathogenic (multiple toxin genes, including aerA, hlyA, and act); moderately pathogenic (some toxin genes, variable haemolytic activity); and potentially non‑pathogenic (few or no toxin genes).

Haemolysis testing (phenotypic) – A qualitative plate assay that supports gene‑based findings. The isolate is streaked onto blood agar base supplemented with 5% sheep (or horse) red blood cells. After 24‑48 hours at 28‑30°C, colonies producing a clear zone of complete lysis are recorded as β‑haemolytic. A zone of partial (greenish) lysis is recorded as α‑haemolytic. Most virulent A. hydrophila isolates are β‑haemolytic, while avirulent environmental isolates may be α‑haemolytic or non‑haemolytic.

3. Standard Test Methods We Apply

All tests are performed according to internationally recognised standards and validated laboratory procedures. Our laboratory is ISO/IEC 17025 accredited (for microbiology and molecular testing) and participates in inter‑laboratory proficiency testing programmes for aquatic pathogen detection.

3.1 Culture‑Based Isolation & Enumeration Standards

ISO 21872‑1:2017 (Microbiology of the food chain – Horizontal method for the detection of potentially enteropathogenic Vibrio spp.) – Although primarily targeting Vibrio, the enrichment and isolation principles are applicable to Aeromonas detection in seafood; we supplement with Aeromonas‑specific selective agars for confirmatory isolation.

SN/T 0751‑2010 (Import and export food safety standard – Detection of Aeromonas hydrophila). – Specific Chinese standard for processed seafood export compliance; includes enrichment in alkaline peptone water (APW) and plating on RS agar and TSA.

SC/T 7201.3‑2006 (Fish bacterial disease quarantine technical specification – Part 3: Diagnostic method for Aeromonas hydrophila and Aeromonas caviae enteritis). – This standard specifies the detailed procedure for isolation from kidney, spleen, liver, and ascites; biochemical characterisation; and the histopathological criteria used in official fish health certification[reference:15].

SC/T 7014‑2006 (Aquatic animal quarantine laboratory technical specifications). – This standard provides the framework for sample collection, handling, and processing for all bacterial pathogens in aquatic animals, including A. hydrophila, and is the mandatory reference for all quarantine testing in China[reference:16].

3.2 Molecular Detection (PCR & Real‑Time qPCR) Protocols

Conventional PCR (end‑point) – Primers are designed against genus‑specific 16S rDNA for initial screening (forward: 5‘‑GAGTTTGATCATGGCTCAG‑3‘, reverse: 5‘‑TACGGTTACCTTGTTACGACTT‑3‘), producing a 1,500 bp amplicon. For species‑specific identification, we use primers targeting the hlyA haemolysin gene: forward (5‘‑GCCGAGCGCCCGGAAGGTGAG‑3‘) and reverse (5‘‑GAGCGGCTGGATGCGGTTGT‑3‘), producing a 592 bp product. For toxigenic strain differentiation, we use multiplex PCR incorporating primers for aerA, hlyA, act, alt, and ast in a single reaction.[reference:17][reference:18]

Real‑time quantitative PCR (qPCR) – Our qPCR assay targets the hlyA gene, offering lower detection limits (< 10 CFU/reaction), faster time‑to‑result (< 3 hours), and simultaneous quantification of bacterial load in tissue or water samples. The assay uses the same primer set as conventional PCR but includes a TaqMan® probe (5‘‑FAM‑CATCGGCTACGTCTTCC‑MGB‑3‘). The limit of detection (LOD) is 5 CFU per reaction (or 5 CFU/g tissue after enrichment). Results are reported as genome equivalents (GE) per gram or per millilitre.

Multiplex PCR for multiple aquatic pathogens – We offer a validated multiplex PCR panel that simultaneously detects A. hydrophila, Edwardsiella tarda, and Streptococcus iniae in a single reaction – a cost‑effective option for routine surveillance programmes. The primer sets are designed with distinct amplicon sizes for easy gel‑based differentiation[reference:19].

Colony PCR (direct from colonies) – For high‑throughput screening of multiple isolates, we perform PCR directly from bacterial colonies on the primary isolation plate without prior DNA extraction. A single colony is lysed in 20 μL of lysis buffer (50 mM NaOH, 0.1% SDS, 2 min 95°C), and 1 μL is used as the template for PCR. This method reduces the time to confirm a suspect colony from 24 hours (requiring a purified broth culture) to just 4‑5 hours after primary colony growth[reference:20].

3.3 Immunological & Serological Detection (ELISA & Lateral Flow)

For rapid screening of large numbers of samples without bacterial culture (e.g., serosurveillance), we offer enzyme‑linked immunosorbent assay (ELISA) based on polyclonal antibodies raised against whole‑cell antigens of A. hydrophila.

Indirect ELISA (screening) – Microtiter plates coated with inactivated A. hydrophila whole‑cell antigen at 5 μg/mL. Patient or fish serum is diluted (1:100) and applied, followed by HRP‑conjugated anti‑species antibody. After TMB substrate addition and stop (2 M H₂SO₄), the absorbance is read at 450 nm. A positive cut‑off is defined as the mean + 3SD of known negative control sera.[reference:21]

Dot‑ELISA (for field or resource‑limited use) – Antigen is spotted onto a nitrocellulose membrane rather than a microtiter plate. The membrane is then probed with serum, and a positive result appears as a visible coloured dot after enzymatic development. This format is compatible with field‑portable equipment and gives a visual result without a plate reader.[reference:22]

BA‑ELISA (biotin‑streptavidin amplification) – For detection directly in infected tissues (e.g., liver, kidney) without prior bacterial isolation. This method uses a biotinylated detection antibody and streptavidin‑HRP amplification to achieve higher sensitivity, suitable for early‑stage infections where bacterial load is low (< 100 CFU/g).[reference:23]

4. Why Choose Our Third‑Party Aeromonas hydrophila Detection Services?

As an independent laboratory with specialised expertise in aquatic microbiology, we provide unbiased, accurate, and legally defensible data. Our strengths include:

ISO/IEC 17025 accreditation – Our A. hydrophila detection services (culture, biochemical, and molecular) are CNAS/CMA accredited, with regular participation in proficiency testing (e.g., FAPAS, LGC, Chinese NIL proficiency rounds).

Integrated diagnostic workflow – We offer a complete service from sample receipt to report, including macroscopic examination (post‑mortem), primary culture, biochemical confirmation, and molecular typing – all in one facility, without sub‑contracting.

Specialist aquatic microbiology expertise – Our team includes veterinary microbiologists with extensive experience in distinguishing A. hydrophila from other Aeromonas species and from phenotypically similar aquatic bacteria.

Large‑scale surveillance – For industry‑wide surveillance (e.g., hatchery certification, broodstock screening), we can process batches of up to 500 samples per week using automated DNA extraction and real‑time PCR workflows.

Rapid turnaround times – Direct colony confirmation by MALDI‑TOF MS: < 24 hours from receipt of a bacterial isolate. Real‑time PCR for hlyA: results within 4‑6 hours of sample receipt. Full culture‑based identification (isolation + API 20E + PCR): 3‑5 business days. Urgent outbreak investigations can be expedited.

Comprehensive interpretive reporting – Our reports include macroscopic lesion descriptions (when relevant), colony morphology images, biochemical test results, PCR gel images (or qPCR amplification curves), and a clear conclusion (positive/negative for A. hydrophila, and if positive, the toxigenic profile of the isolate).

Confidentiality – Full protection of your facility data, pathogen status, and intellectual property.

Consultative support – Our aquatic pathologists assist with: result interpretation and correlation with clinical signs; isolation technique optimisation for low‑bioburden samples; advice on biosecurity measures and disinfection protocols; and support for regulatory submissions (import/export certificates, OIE annual reporting).

Whether you need to investigate a sudden mass mortality in a commercial shrimp pond, certify a hatchery as free of pathogenic A. hydrophila, screen broodstock for carrier status, or comply with import health requirements for live fish, our Aeromonas hydrophila detection experts are ready to deliver reliable, actionable results.

Get Started with Your Aeromonas hydrophila Testing Project

Contact our team with your sample type (fish tissue, water, feed, swabs), detection objective (screening, diagnosis, certification, surveillance), and required standard (SC/T 7201.3, SN/T 0751, ISO, OIE). We will provide a detailed quotation, sample submission guidelines (minimum sample size, preservation, cold‑chain requirements), and a testing schedule. Let us help you safeguard aquatic animal health and water quality with accurate, timely pathogen detection.

This article provides an overview of our Aeromonas hydrophila detection capabilities. For specific test methods, sample quantity, and pricing, please request a tailored service proposal.